Journal: Breast cancer research and treatment

Article Title: Viral transduction of the HER2-extracellular domain expands trastuzumab-based photoimmunotherapy for HER2-negative breast cancer cells.

doi: 10.1007/s10549-015-3265-y

Figure Lengend Snippet: Fig. 1 HER2-extracellular domain (ECD) expression induced by Ad- HER2-ECD. a Western blot analysis showing expression of the 100-kDa HER2-ECD protein in Ad-HER2-ECD-infected cells but not in Ad-GFP-infected or parental cells. Actin was used as a loading control. b Flowcytometric analysis showing HER2-ECD expression on the cell membrane. Cells were labeled with APC-conjugated

Article Snippet: In experiments with replication-deficient adenoviral vector, cells were infected with Ad-HER2-ECD or Ad-GFP at a multiplicity of infection (MOI) of 50 for 48 h. Flowcytometric analysis To measure the expression of HER2-ECD in cells infected with Ad-HER2-ECD, cells were labeled with APC-conjugated mouse monoclonal anti-HER2-ECD antibody (R&D Systems Inc.) or APC-conjugated IgG2b as control (Miltenyi Biotec, Inc.) on ice for 45 min and were then analyzed using a FACS instrument (BD Biosciences).

Techniques: Expressing, Western Blot, Infection, Control, Membrane, Labeling

Journal: Breast cancer research and treatment

Article Title: Viral transduction of the HER2-extracellular domain expands trastuzumab-based photoimmunotherapy for HER2-negative breast cancer cells.

doi: 10.1007/s10549-015-3265-y

Figure Lengend Snippet: Fig. 2 Trastzumab-IR700 binds to the transduced cell surface HER2- ECD Immunofluorescent analysis of Trastzumab-IR700 (Tra-IR700) binding to HER2-ECD-transduced by Ad-HER2-ECD on the cell surface of breast cancer cells. Scale bars 50 lm

Article Snippet: In experiments with replication-deficient adenoviral vector, cells were infected with Ad-HER2-ECD or Ad-GFP at a multiplicity of infection (MOI) of 50 for 48 h. Flowcytometric analysis To measure the expression of HER2-ECD in cells infected with Ad-HER2-ECD, cells were labeled with APC-conjugated mouse monoclonal anti-HER2-ECD antibody (R&D Systems Inc.) or APC-conjugated IgG2b as control (Miltenyi Biotec, Inc.) on ice for 45 min and were then analyzed using a FACS instrument (BD Biosciences).

Techniques: Binding Assay

Journal: Breast cancer research and treatment

Article Title: Viral transduction of the HER2-extracellular domain expands trastuzumab-based photoimmunotherapy for HER2-negative breast cancer cells.

doi: 10.1007/s10549-015-3265-y

Figure Lengend Snippet: Fig. 3 Microscopic analysis of the effect of Tra-IR700-mediated PIT on the cell morphology and cell death of HER2-ECD-transduced HER2-negative cells. a Phase contrast analysis of the morphology of the breast cancer cells MCF-7 and MDA-MB-231 immediately following PIT using 0, 6, or 18 J. Scale bars 50 lm. b Phase contrast analysis of control, Ad-GFP-infected or Ad-HER2-ECD-infected MCF-7 and MDA-MB-231 cells before and after 72 h treatment with

Article Snippet: In experiments with replication-deficient adenoviral vector, cells were infected with Ad-HER2-ECD or Ad-GFP at a multiplicity of infection (MOI) of 50 for 48 h. Flowcytometric analysis To measure the expression of HER2-ECD in cells infected with Ad-HER2-ECD, cells were labeled with APC-conjugated mouse monoclonal anti-HER2-ECD antibody (R&D Systems Inc.) or APC-conjugated IgG2b as control (Miltenyi Biotec, Inc.) on ice for 45 min and were then analyzed using a FACS instrument (BD Biosciences).

Techniques: Control, Infection

Journal: Breast cancer research and treatment

Article Title: Viral transduction of the HER2-extracellular domain expands trastuzumab-based photoimmunotherapy for HER2-negative breast cancer cells.

doi: 10.1007/s10549-015-3265-y

Figure Lengend Snippet: Fig. 4 Effect of Tra-IR700 mediated PIT treatment of HER2-ECD transduced HER2-negative cells on cell viability. Tra-IR700-medi- ated PIT was applied to the indicated cells along with seven control conditions and cell viability was quantified 72 h after PIT (24 J for MDA-MB-231 and 36 J for MCF-7) using the XTT assay. Only the

Article Snippet: In experiments with replication-deficient adenoviral vector, cells were infected with Ad-HER2-ECD or Ad-GFP at a multiplicity of infection (MOI) of 50 for 48 h. Flowcytometric analysis To measure the expression of HER2-ECD in cells infected with Ad-HER2-ECD, cells were labeled with APC-conjugated mouse monoclonal anti-HER2-ECD antibody (R&D Systems Inc.) or APC-conjugated IgG2b as control (Miltenyi Biotec, Inc.) on ice for 45 min and were then analyzed using a FACS instrument (BD Biosciences).

Techniques: Control, XTT Assay

Journal:

Article Title: Glycated LDL increases monocyte CC chemokine receptor 2 expression and monocyte chemoattractant protein-1-mediated chemotaxis

doi: 10.1016/j.atherosclerosis.2007.10.035

Figure Lengend Snippet: AGE-LDL increased cell surface expression of CCR2. Macrophages were incubated in the presence of either LDL or AGE-LDL for 48 hours, and CCR2 surface expression was determined by flow cytometry with anti-CCR2 IgG and expressed as specific mean fluorescence intensity (MFI). Data are shown as mean ± SEM (n=3). The experiments were done twice for each donor.

Article Snippet: An anti-human Receptor for AGE (RAGE) mouse monoclonal antibody and its IgG2b isotype control (R&D systems) served to test the involvement of RAGE by blocking receptor-ligand interactions. table ft1 table-wrap mode="anchored" t5 caption a7 Forward Reverse CCR2 TCCATTCTCTCAGGCTTGC TGAGCATCAAGGACATCTG GAPDH TGAAGGTCGGAGTCAACGGATTTGGTCGTA ATCTCGCTCCTGGAAGATGGTGATGGGATT Open in a separate window CC chemokine receptor 2 (CCR2); glyceraldehyde 3-phosphate dehydrogenase (GAPDH) caption a8 PCR primers

Techniques: Expressing, Incubation, Flow Cytometry, Fluorescence

Journal: iScience

Article Title: Broad anti-sarbecovirus responses elicited by a single administration of mosaic-8 RBD-nanoparticle vaccine prepared using atomic layer deposition

doi: 10.1016/j.isci.2025.113649

Figure Lengend Snippet: ALD-coated mosaic-8b immunization elicits an IgG1-dominated response Analysis of binding interactions of IgG1, IgG2a, IgG2b, IgG3, FcγR2b-binding IgGs, FcγR3-binding IgGs, FcγR4-binding IgGs, and total IgG with the indicated spikes, RBDs, or a non-sarbecovirus control protein. Antigen names (y axes) are colored to identify clades from which spikes or RBDs were derived. Matched antigens are indicated with gray shading around the name, mismatched antigens are indicated with a black outline around the name, and WA1 antigens that are matched to the WA1 pre-vaccination are indicated with a dashed black outline around the name. (A and B) Serum from mice immunized with ALD mix3, ALD mix4, SD, and conventional mosaic-8b (x axes) in originally naive (A) or pre-vaccinated (B) cohorts was tested for binding against different sarbecovirus spikes and RBDs (y axes). Each vertical line of binding data represents an individual mouse, and immunization groups are separated by a vertical black line. Unimmunized = Day 0 serum from a naive mouse prior to mosaic-8b immunization. MFI = median fluorescent intensity.

Article Snippet: Goat Anti-Mouse IgG2b, Human ads-PE , Southern Biotech , Cat # 1090-09S; RRID: AB_2794524.

Techniques: Binding Assay, Control, Derivative Assay

Journal: iScience

Article Title: Broad anti-sarbecovirus responses elicited by a single administration of mosaic-8 RBD-nanoparticle vaccine prepared using atomic layer deposition

doi: 10.1016/j.isci.2025.113649

Figure Lengend Snippet: ALD-coated mosaic-8b immunization elicits different IgG subclass and FcγR responses than conventional mosaic-8b immunizations (A and B) For IgG1, IgG2a, IgG2b, IgG3, FcγR2b-binding IgGs, FcγR3-binding IgGs, FcγR4-binding IgGs, and total IgG, geomean MFI (geometric median fluorescent intensity) values from the naive cohort (A) or the pre-vaccinated cohort (B) are represented as points corresponding to different spikes or RBDs (individual responses shown in ) and compared pairwise across immunization cohorts by Tukey’s multiple comparison test calculated by GraphPad Prism. Data for each immunization group are visualized using box and whisker plots. The boxes display the range between the upper and lower quartiles, with a line denoting the median value. The whiskers extend to the minimum and maximum values, excluding any outliers. Significant differences between cohorts linked by vertical lines in panels B and C are indicated by asterisks: p < 0.05 = ∗, p < 0.01 = ∗∗, p < 0.001 = ∗∗∗, p < 0.0001 = ∗∗∗∗.

Article Snippet: Goat Anti-Mouse IgG2b, Human ads-PE , Southern Biotech , Cat # 1090-09S; RRID: AB_2794524.

Techniques: Binding Assay, Comparison, Whisker Assay